Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 2799986
End position: 2800030
Length: 45

DNA sequence
>NC_018876, from 2799986 to 2800030 (45 bp); Methanolobus psychrophilus R15 CTCAAATTTGCCTCCCTCAAATTTGCTTCTTTCAGATTTGCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2799452-2800708	Sequence	Mpsy_2930 - pentapeptide repeat protein (Protein is coded in complementary strand; from 2800708 to 2799452)