Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 1468632
End position: 1468676
Length: 45

DNA sequence
>NC_018876, from 1468632 to 1468676 (45 bp); Methanolobus psychrophilus R15 CCTGGAGTTTCATCAACTGGGGTCTCATCAACTGGAGTCTCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1468527-1471265	Sequence	Mpsy_1486 - hypothetical protein (Protein is coded in complementary strand; from 1471265 to 1468527)