Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 473807
End position: 473842
Length: 36

DNA sequence
>NC_018876, from 473807 to 473842 (36 bp); Methanolobus psychrophilus R15 GGAGTATTATCAGAGGTATTATCAGGAGTATTATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 472139-474031	Sequence	Mpsy_0476 - histone deacetylase superfamily (Protein is coded in complementary strand; from 474031 to 472139)