Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 2162830
End position: 2162865
Length: 36

DNA sequence
>NC_018876, from 2162830 to 2162865 (36 bp); Methanolobus psychrophilus R15 AAACTTCGGGGGTGACTTCGGGGGTGACTTCGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2162611-2163318	Sequence	Mpsy_2242 - putative transcriptional regulator (Protein is coded in complementary strand; from 2163318 to 2162611)