Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 627910
End position: 627936
Length: 27

DNA sequence
>NC_018876, from 627910 to 627936 (27 bp); Methanolobus psychrophilus R15 CTTCATCCTCTTCATCCTCTTCATCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 627849-628484	Sequence	Mpsy_0649 - hypothetical protein (Protein is coded in complementary strand; from 628484 to 627849)