Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 627016
End position: 627042
Length: 27

DNA sequence
>NC_018876, from 627016 to 627042 (27 bp); Methanolobus psychrophilus R15 ATCTTCTTCATCCTCTTCATCCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 627033-627614	Sequence	Mpsy_0648 - hypothetical protein (Protein is coded in complementary strand; from 627614 to 627033)