Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 621528
End position: 621554
Length: 27

DNA sequence
>NC_018876, from 621528 to 621554 (27 bp); Methanolobus psychrophilus R15 CATGTCTTCCATGTCCTCCATCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 619924-623247	Sequence	Mpsy_0644 - GLUG domain protein (Protein is coded in complementary strand; from 623247 to 619924)