Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 626452
End position: 626475
Length: 24

DNA sequence
>NC_018876, from 626452 to 626475 (24 bp); Methanolobus psychrophilus R15 TTATTTTTATTTCTATTTTTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 624760-626619	Sequence	Mpsy_0647 - hypothetical protein (Protein is coded in complementary strand; from 626619 to 624760)