Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 2770943
End position: 2770966
Length: 24

DNA sequence
>NC_018876, from 2770943 to 2770966 (24 bp); Methanolobus psychrophilus R15 GTTCTCGATCTCTTTCTCGATCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2770017-2771438	Sequence	Mpsy_2893 - acetyl-CoA decarbonylase/synthase complex subunit beta (Protein is coded in complementary strand; from 2771438 to 2770017)