Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 190834
End position: 190857
Length: 24

DNA sequence
>NC_018876, from 190834 to 190857 (24 bp); Methanolobus psychrophilus R15 TTTGCTTTTGCTCTTGCTTTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 190438-191088	Sequence	Mpsy_0178 - hypothetical protein (Protein is coded in complementary strand; from 191088 to 190438)