Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 980599
End position: 980626
Length: 28

DNA sequence
>NC_018691, from 980599 to 980626 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 980624-981556	Sequence	B5T_00917 - Alpha/beta hydrolase fold domain protein (Protein is coded in complementary strand; from 981556 to 980624)