Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 968300
End position: 968327
Length: 28

DNA sequence
>NC_018691, from 968300 to 968327 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 968325-969203	Sequence	B5T_00903 - hypothetical protein (Protein is coded in complementary strand; from 969203 to 968325)