Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 895271
End position: 895294
Length: 24

DNA sequence
>NC_018691, from 895271 to 895294 (24 bp); Alcanivorax dieselolei B5 TGGCGCTGGCGTAGGCGCCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 894511-895515	Sequence	B5T_00840 livM Branched-chain amino acid transport system permease protein (Protein is coded in complementary strand; from 895515 to 894511)