Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 685128
End position: 685155
Length: 28

DNA sequence
>NC_018691, from 685128 to 685155 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 685153-686157	Sequence	B5T_00656 - Transcriptional regulator, AraC family protein (Protein is coded in complementary strand; from 686157 to 685153)