Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4835799
End position: 4835843
Length: 45

DNA sequence
>NC_018691, from 4835799 to 4835843 (45 bp); Alcanivorax dieselolei B5 CTCCCTCTACAGCACGTCCCTCTACAAAACGTCCTTCTACAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4835836-4838049	Sequence	B5T_04373 uvrD UvrD/REP helicase domain protein (Protein is coded in complementary strand; from 4838049 to 4835836)