Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4835628
End position: 4835651
Length: 24

DNA sequence
>NC_018691, from 4835628 to 4835651 (24 bp); Alcanivorax dieselolei B5 GCCCAGCCCCAGGCCCAGGCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4834543-4835679	Sequence	B5T_04372 - TRAP-type transports system extracellular solute binding protein (Protein is coded in complementary strand; from 4835679 to 4834543)