Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4741753
End position: 4741780
Length: 28

DNA sequence
>NC_018691, from 4741753 to 4741780 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4741771-4742262	Sequence	B5T_04274 gshPx Glutathione peroxidase (Protein is coded in complementary strand; from 4742262 to 4741771)