Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4620290
End position: 4620317
Length: 28

DNA sequence
>NC_018691, from 4620290 to 4620317 (28 bp); Alcanivorax dieselolei B5 CACTGTCAACTGTCCACTATCAACTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4620317-4620907	Sequence	B5T_04170 - 2-hydroxychromene-2-carboxylate isomerase, putative (Protein is coded in complementary strand; from 4620907 to 4620317)