Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4587994
End position: 4588021
Length: 28

DNA sequence
>NC_018691, from 4587994 to 4588021 (28 bp); Alcanivorax dieselolei B5 CAGTTGACAGTTGACAGTGGATAGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4586552-4588081	Sequence	B5T_04137 cobQ Adenosylcobyric acid synthase (Glutamine-hydrolysing) (Protein is coded in complementary strand; from 4588081 to 4586552)