Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 452379
End position: 452402
Length: 24

DNA sequence
>NC_018691, from 452379 to 452402 (24 bp); Alcanivorax dieselolei B5 CAGCCCCAGCGCCAGCACCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 450520-453576	Sequence	B5T_00439 - RND transporter, HAE1/HME family, permease protein (Protein is coded in complementary strand; from 453576 to 450520)