Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4472173
End position: 4472196
Length: 24

DNA sequence
>NC_018691, from 4472173 to 4472196 (24 bp); Alcanivorax dieselolei B5 CACCACCAGCACCGCCACCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4471733-4472386	Sequence	B5T_04037 - hypothetical protein (Protein is coded in complementary strand; from 4472386 to 4471733)