Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4452811
End position: 4452840
Length: 30

DNA sequence
>NC_018691, from 4452811 to 4452840 (30 bp); Alcanivorax dieselolei B5 CAGCAGCGGCAGCAGCAGGAGCAGGAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4450505-4452907	Sequence	B5T_04014 - Outer membrane ferric siderophore receptor (Protein is coded in complementary strand; from 4452907 to 4450505)