Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4138827
End position: 4138850
Length: 24

DNA sequence
>NC_018691, from 4138827 to 4138850 (24 bp); Alcanivorax dieselolei B5 GTCATCGTCATCGTCGTCGTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4138798-4139982	Sequence	B5T_03727 - GTPase obg (Protein is coded in complementary strand; from 4139982 to 4138798)