Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4130595
End position: 4130622
Length: 28

DNA sequence
>NC_018691, from 4130595 to 4130622 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4130620-4131090	Sequence	B5T_03720 fkpB Peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 4131090 to 4130620)