Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 4079152
End position: 4079179
Length: 28

DNA sequence
>NC_018691, from 4079152 to 4079179 (28 bp); Alcanivorax dieselolei B5 GCGTGTTGCGTGTTGCGTGCTGCGTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4079131-4080198	Sequence	B5T_03678 queA S-adenosylmethionine:tRNA ribosyltransferase-isomerase (Protein is coded in complementary strand; from 4080198 to 4079131)