Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3896849
End position: 3896876
Length: 28

DNA sequence
>NC_018691, from 3896849 to 3896876 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3896867-3897721	Sequence	B5T_03499 - Ribosomal RNA small subunit methyltransferase I (Protein is coded in complementary strand; from 3897721 to 3896867)