Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3804854
End position: 3804877
Length: 24

DNA sequence
>NC_018691, from 3804854 to 3804877 (24 bp); Alcanivorax dieselolei B5 GCGCCAGCACCAGCGCCGCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3804226-3805122	Sequence	B5T_03409 - Beta-lactamase protein (Protein is coded in complementary strand; from 3805122 to 3804226)