Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3725609
End position: 3725632
Length: 24

DNA sequence
>NC_018691, from 3725609 to 3725632 (24 bp); Alcanivorax dieselolei B5 CAGATCCAGTTCCATATCCAGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3724542-3726200	Sequence	B5T_03340 - FAD binding domain protein (Protein is coded in complementary strand; from 3726200 to 3724542)