Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3595828
End position: 3595863
Length: 36

DNA sequence
>NC_018691, from 3595828 to 3595863 (36 bp); Alcanivorax dieselolei B5 GGCTCCGGTTTCGGTTTCGGTTTCGGTTCCGGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3595411-3596220	Sequence	B5T_03227 - Protein TolA (Protein is coded in complementary strand; from 3596220 to 3595411)