Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3445982
End position: 3446017
Length: 36

DNA sequence
>NC_018691, from 3445982 to 3446017 (36 bp); Alcanivorax dieselolei B5 TTACTTGTTCGGTTACTTGTTCGGTTACTTGTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3445765-3447300	Sequence	B5T_03111 - hypothetical protein (Protein is coded in complementary strand; from 3447300 to 3445765)