Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3438260
End position: 3438283
Length: 24

DNA sequence
>NC_018691, from 3438260 to 3438283 (24 bp); Alcanivorax dieselolei B5 CCACCCCCAGCCCCACCGGCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3437821-3439218	Sequence	B5T_03105 - Cytosine deaminase-related metal-dependent hydrolase (Protein is coded in complementary strand; from 3439218 to 3437821)