Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3348004
End position: 3348045
Length: 42

DNA sequence
>NC_018691, from 3348004 to 3348045 (42 bp); Alcanivorax dieselolei B5 CTCATTGCACTTCCCTCATTGCACTACCCTCATCGCACGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3347326-3348009	Sequence	B5T_03022 - ABC-type antimicrobial peptide transport system ATPase component (Protein is coded in complementary strand; from 3348009 to 3347326)