Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 3091151
End position: 3091182
Length: 32

DNA sequence
>NC_018691, from 3091151 to 3091182 (32 bp); Alcanivorax dieselolei B5 AACTAACTAACTAACTAACTAACTAACTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3090189-3091157	Sequence	B5T_02788 - Glucose/ribitol short chain dehydrogenase/reductase family protein