Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2940827
End position: 2940854
Length: 28

DNA sequence
>NC_018691, from 2940827 to 2940854 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTGTCAACTATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2940852-2941955	Sequence	B5T_02645 aroC Chorismate synthase (Protein is coded in complementary strand; from 2941955 to 2940852)