Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2922601
End position: 2922624
Length: 24

DNA sequence
>NC_018691, from 2922601 to 2922624 (24 bp); Alcanivorax dieselolei B5 CGGGCTCGGGTTCCGGCTCGGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2922330-2922959	Sequence	B5T_02629 - Sporulation and cell division repeat protein (Protein is coded in complementary strand; from 2922959 to 2922330)