Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2878548
End position: 2878583
Length: 36

DNA sequence
>NC_018691, from 2878548 to 2878583 (36 bp); Alcanivorax dieselolei B5 GCCTTGTTCGAGGCCCTGTTCGAGGCCTTGTTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2878384-2878731	Sequence	B5T_02586 - Putative transposase (Protein is coded in complementary strand; from 2878731 to 2878384)