Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2736097
End position: 2736124
Length: 28

DNA sequence
>NC_018691, from 2736097 to 2736124 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCAACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2736122-2738014	Sequence	B5T_02483 - Peptidase, M61 (Glycyl aminopeptidase) family protein (Protein is coded in complementary strand; from 2738014 to 2736122)