Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2590741
End position: 2590764
Length: 24

DNA sequence
>NC_018691, from 2590741 to 2590764 (24 bp); Alcanivorax dieselolei B5 GGGAGAGGGACAGGGAAAGGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2590718-2591089	Sequence	B5T_02359 - hypothetical protein (Protein is coded in complementary strand; from 2591089 to 2590718)