Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2449631
End position: 2449690
Length: 60

DNA sequence
>NC_018691, from 2449631 to 2449690 (60 bp); Alcanivorax dieselolei B5 GGAGGCATCTTTTAGGGAGGTATCTTTTAGGGAGGTATCTTTTAGGGAGGTATCTTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2449688-2450113	Sequence	B5T_02229 - hypothetical protein (Protein is coded in complementary strand; from 2450113 to 2449688)