Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2317924
End position: 2317950
Length: 27

DNA sequence
>NC_018691, from 2317924 to 2317950 (27 bp); Alcanivorax dieselolei B5 GTGGGTTGAGTGGGTTGCGTGGATTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2317894-2318352	Sequence	B5T_02121 - hypothetical protein (Protein is coded in complementary strand; from 2318352 to 2317894)