Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2029481
End position: 2029504
Length: 24

DNA sequence
>NC_018691, from 2029481 to 2029504 (24 bp); Alcanivorax dieselolei B5 GCCAGCGCCAGCACCAGCGCCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2029139-2030464	Sequence	B5T_01869 - hypothetical protein (Protein is coded in complementary strand; from 2030464 to 2029139)