Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 2003757
End position: 2003784
Length: 28

DNA sequence
>NC_018691, from 2003757 to 2003784 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2003775-2004872	Sequence	B5T_01848 - Acetyltransferase, GNAT family (Protein is coded in complementary strand; from 2004872 to 2003775)