Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1930842
End position: 1930869
Length: 28

DNA sequence
>NC_018691, from 1930842 to 1930869 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1930867-1931622	Sequence	B5T_01786 - hypothetical protein (Protein is coded in complementary strand; from 1931622 to 1930867)