Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1685948
End position: 1685975
Length: 28

DNA sequence
>NC_018691, from 1685948 to 1685975 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTGTCAACTATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1685966-1686436	Sequence	B5T_01571 - Adenylate cyclase (Protein is coded in complementary strand; from 1686436 to 1685966)