Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1648597
End position: 1648624
Length: 28

DNA sequence
>NC_018691, from 1648597 to 1648624 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1648615-1651329	Sequence	B5T_01542 gacS ATPase, histidine kinase-, DNA gyrase B-, and HSP90-like domain protein (Protein is coded in complementary strand; from 1651329 to 1648615)