Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1648418
End position: 1648445
Length: 28

DNA sequence
>NC_018691, from 1648418 to 1648445 (28 bp); Alcanivorax dieselolei B5 AGTTGACAGTTGATAGTGGACAGTTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1647632-1648465	Sequence	B5T_01541 pdxJ Pyridoxine 5'-phosphate synthase (Protein is coded in complementary strand; from 1648465 to 1647632)