Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1582959
End position: 1583003
Length: 45

DNA sequence
>NC_018691, from 1582959 to 1583003 (45 bp); Alcanivorax dieselolei B5 CGGCCTTCCTTGCGCGGACCTTCCTTGCGCGGGCCGTCCTTGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1582677-1584356	Sequence	B5T_01479 deaD ATP-dependent RNA helicase, DEAD box family (Protein is coded in complementary strand; from 1584356 to 1582677)