Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1503214
End position: 1503241
Length: 28

DNA sequence
>NC_018691, from 1503214 to 1503241 (28 bp); Alcanivorax dieselolei B5 CTGTCAACTGTCCACTATCAACTGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1503232-1504473	Sequence	B5T_01414 - Mg2+ and Co2+ transporter CorB (Protein is coded in complementary strand; from 1504473 to 1503232)