Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1195355
End position: 1195390
Length: 36

DNA sequence
>NC_018691, from 1195355 to 1195390 (36 bp); Alcanivorax dieselolei B5 TTAGTGCCGTGAGTAGTGCCATGACTAGTGCGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1194766-1195359	Sequence	B5T_01105 - SCO1/SenC superfamily
ORF... 1195376-1195801	Sequence	B5T_01106 - hypothetical protein