Sequence retrieval

Genome: Alcanivorax dieselolei B5
Start position: 1189854
End position: 1189877
Length: 24

DNA sequence
>NC_018691, from 1189854 to 1189877 (24 bp); Alcanivorax dieselolei B5 GCGCCAGCGCCCGGGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1189217-1190311	Sequence	B5T_01100 - Sulfate ABC transporter, ATPase subunit (Protein is coded in complementary strand; from 1190311 to 1189217)